ID: 902379071_902379082

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 902379071 902379082
Species Human (GRCh38) Human (GRCh38)
Location 1:16044171-16044193 1:16044219-16044241
Sequence CCACCGAAGGGGAAGGGGCTCTG CCCAGTCTGCTGCTGGACACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 181} {0: 1, 1: 2, 2: 2, 3: 34, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!