ID: 902398460_902398465

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 902398460 902398465
Species Human (GRCh38) Human (GRCh38)
Location 1:16144848-16144870 1:16144883-16144905
Sequence CCTCATCTGTAAAATGGGGATCA CTCTGGGTTGTGTGTGAAGATGG
Strand - +
Off-target summary {0: 18, 1: 452, 2: 2038, 3: 5504, 4: 10610} {0: 1, 1: 0, 2: 1, 3: 16, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!