ID: 902398998_902399011

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 902398998 902399011
Species Human (GRCh38) Human (GRCh38)
Location 1:16147341-16147363 1:16147389-16147411
Sequence CCCTCCAACCTCTCCCTCAACAG TGATCCTGATATGCAGCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 404} {0: 1, 1: 0, 2: 5, 3: 31, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!