ID: 902410045_902410053

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 902410045 902410053
Species Human (GRCh38) Human (GRCh38)
Location 1:16207098-16207120 1:16207114-16207136
Sequence CCCCGGCCCCTCCTCTGCGCCCT GCGCCCTCGGCCTCGTCCCCCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 10, 3: 94, 4: 790} {0: 1, 1: 0, 2: 1, 3: 29, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!