ID: 902435439_902435442

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 902435439 902435442
Species Human (GRCh38) Human (GRCh38)
Location 1:16395471-16395493 1:16395490-16395512
Sequence CCAGTGCCAGCAATAACAGTTTA TTTATCATGCTCATTAATTTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 0, 3: 8, 4: 98} {0: 4, 1: 0, 2: 4, 3: 41, 4: 359}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!