ID: 902443584_902443589

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 902443584 902443589
Species Human (GRCh38) Human (GRCh38)
Location 1:16447399-16447421 1:16447424-16447446
Sequence CCTTCTTTCCTCGGGGCTCACTG CCCTCTTATAGTCCTGCCTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 200} {0: 1, 1: 0, 2: 0, 3: 9, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!