ID: 902464568_902464578

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 902464568 902464578
Species Human (GRCh38) Human (GRCh38)
Location 1:16608070-16608092 1:16608094-16608116
Sequence CCAGGACAGTGTAGGAGCCTTAG CTGGGGGATGCAGGTGGACAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 11, 4: 99} {0: 3, 1: 6, 2: 4, 3: 58, 4: 477}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!