ID: 902465291_902465305

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 902465291 902465305
Species Human (GRCh38) Human (GRCh38)
Location 1:16613609-16613631 1:16613662-16613684
Sequence CCAAGGCGCAGGCGCGGCGGGGC AACGGGTTCGAGCAGGTTAGGGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 6, 3: 26, 4: 245} {0: 1, 1: 2, 2: 1, 3: 1, 4: 41}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!