ID: 902546194_902546199

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 902546194 902546199
Species Human (GRCh38) Human (GRCh38)
Location 1:17191979-17192001 1:17192023-17192045
Sequence CCCTCTTCCTTCTCCTTTTTCTT GAGTCTCACTCTGCTGCCCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!