ID: 902609704_902609707

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 902609704 902609707
Species Human (GRCh38) Human (GRCh38)
Location 1:17589782-17589804 1:17589796-17589818
Sequence CCAGGGGTGAAGTTGTGGAGAAA GTGGAGAAACTCAGTCTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 190} {0: 1, 1: 0, 2: 2, 3: 16, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!