ID: 902624042_902624055

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 902624042 902624055
Species Human (GRCh38) Human (GRCh38)
Location 1:17666639-17666661 1:17666689-17666711
Sequence CCTTTCTCCCCCAAGAACAGCTG CCAGCCCCTGGTTCATGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 294} {0: 2, 1: 1, 2: 1, 3: 23, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!