ID: 902628723_902628728

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 902628723 902628728
Species Human (GRCh38) Human (GRCh38)
Location 1:17692121-17692143 1:17692144-17692166
Sequence CCATCATAGTTCTGAGCCTTCAC TTTTGGAATGGATTTAGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134} {0: 1, 1: 0, 2: 1, 3: 19, 4: 457}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!