ID: 902711447_902711456

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 902711447 902711456
Species Human (GRCh38) Human (GRCh38)
Location 1:18242851-18242873 1:18242868-18242890
Sequence CCTAGAGATGCCATCCCTGGCTC TGGCTCACACTCTGCTGGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 289} {0: 1, 1: 0, 2: 2, 3: 23, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!