ID: 902728685_902728693

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 902728685 902728693
Species Human (GRCh38) Human (GRCh38)
Location 1:18354112-18354134 1:18354140-18354162
Sequence CCAGGCACCCAGAGGACAGGCTC CTGTCTGGAAAAACCTGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 323} {0: 1, 1: 0, 2: 1, 3: 22, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!