ID: 902769326_902769335

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 902769326 902769335
Species Human (GRCh38) Human (GRCh38)
Location 1:18636625-18636647 1:18636657-18636679
Sequence CCCGGGAGAGCCCGGCTGCGGGG TGGTCTACCCCAATACTGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 408} {0: 1, 1: 0, 2: 1, 3: 1, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!