ID: 902773229_902773243

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 902773229 902773243
Species Human (GRCh38) Human (GRCh38)
Location 1:18658293-18658315 1:18658335-18658357
Sequence CCATCCTGGCTGTGTCTTCGAGG CTGGAAGACAGCAAGAGAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 163} {0: 1, 1: 0, 2: 4, 3: 68, 4: 618}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!