ID: 902774239_902774252

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 902774239 902774252
Species Human (GRCh38) Human (GRCh38)
Location 1:18664423-18664445 1:18664445-18664467
Sequence CCTGGAAGAGGGAACACCATGCC CTGGGGAAGGGGAGGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 390} {0: 2, 1: 4, 2: 73, 3: 556, 4: 4173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!