ID: 902805306_902805313

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 902805306 902805313
Species Human (GRCh38) Human (GRCh38)
Location 1:18857618-18857640 1:18857660-18857682
Sequence CCTTCACTTCATACCTGGAGGGG AAGCAGATCCAGAATGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 125} {0: 1, 1: 0, 2: 3, 3: 33, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!