ID: 902814270_902814276

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 902814270 902814276
Species Human (GRCh38) Human (GRCh38)
Location 1:18907311-18907333 1:18907355-18907377
Sequence CCCGACTGGCCAGTCGAGGGAAC GTCGAGGAGCAGAAAGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80} {0: 1, 1: 0, 2: 0, 3: 98, 4: 856}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!