ID: 902890235_902890237

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 902890235 902890237
Species Human (GRCh38) Human (GRCh38)
Location 1:19438054-19438076 1:19438071-19438093
Sequence CCAAGTATTGTTCTTACCTCCCA CTCCCACTACCTCCTACGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 160} {0: 1, 1: 0, 2: 2, 3: 9, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!