ID: 902921071_902921086

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 902921071 902921086
Species Human (GRCh38) Human (GRCh38)
Location 1:19666187-19666209 1:19666239-19666261
Sequence CCCTAGTCCTGGGCGCCTGGAGC GCTGCTGGGCTGGCACGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 174} {0: 1, 1: 0, 2: 5, 3: 42, 4: 346}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!