ID: 902931163_902931166

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 902931163 902931166
Species Human (GRCh38) Human (GRCh38)
Location 1:19732503-19732525 1:19732521-19732543
Sequence CCAGCGTCCTTTCTCACCTCCTC TCCTCTCTAGATGATCAATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 67, 4: 598} {0: 1, 1: 0, 2: 0, 3: 11, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!