ID: 902931734_902931751

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 902931734 902931751
Species Human (GRCh38) Human (GRCh38)
Location 1:19736313-19736335 1:19736348-19736370
Sequence CCCCCCTGATTCAATTACCTCCC CCATGACCCATGTGGATTGTGGG
Strand - +
Off-target summary {0: 19, 1: 3127, 2: 6337, 3: 9318, 4: 9980} {0: 1, 1: 0, 2: 50, 3: 725, 4: 1772}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!