ID: 902955516_902955518

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 902955516 902955518
Species Human (GRCh38) Human (GRCh38)
Location 1:19922214-19922236 1:19922243-19922265
Sequence CCATCAGGAGGGGCTTCCTGTCT GCCTCCACCCACCTCACCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 215} {0: 1, 1: 0, 2: 1, 3: 28, 4: 496}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!