|
Left Crispr |
Right Crispr |
Crispr ID |
902970508 |
902970516 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:20044777-20044799
|
1:20044808-20044830
|
Sequence |
CCTGATTCAGCCTGGCAGGGTGC |
GTGGAGCAGTCTAGGGAGGAGGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 7, 2: 20, 3: 36, 4: 604} |
{0: 1, 1: 1, 2: 26, 3: 306, 4: 509} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|