ID: 902983639_902983646

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 902983639 902983646
Species Human (GRCh38) Human (GRCh38)
Location 1:20142448-20142470 1:20142484-20142506
Sequence CCAGGCTGGGCGTGTGGACCCAG AGGATGTGCAGAGGCAGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 311} {0: 1, 1: 0, 2: 1, 3: 32, 4: 400}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!