ID: 903059198_903059204

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 903059198 903059204
Species Human (GRCh38) Human (GRCh38)
Location 1:20657771-20657793 1:20657822-20657844
Sequence CCTATATTCTCTACCTCTGCCTC TACTCTCCTTTGGAGAGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 406} {0: 1, 1: 0, 2: 1, 3: 15, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!