ID: 903077886_903077893

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 903077886 903077893
Species Human (GRCh38) Human (GRCh38)
Location 1:20786583-20786605 1:20786596-20786618
Sequence CCGCGGCGCCCGCCCCGGCGACG CCCGGCGACGGAAGCAGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 74, 4: 525} {0: 1, 1: 0, 2: 1, 3: 17, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!