ID: 903126375_903126380

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 903126375 903126380
Species Human (GRCh38) Human (GRCh38)
Location 1:21250975-21250997 1:21251024-21251046
Sequence CCAGCCTGGGCGACAGAGCGAGA CTGAATTTGCAGATGGGGTAAGG
Strand - +
Off-target summary {0: 26768, 1: 89687, 2: 191248, 3: 194442, 4: 151704} {0: 1, 1: 0, 2: 1, 3: 23, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!