ID: 903130977_903130988

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 903130977 903130988
Species Human (GRCh38) Human (GRCh38)
Location 1:21279373-21279395 1:21279392-21279414
Sequence CCCGGGCCCCGCTTCCCTTGGAG GGAGGAAGGGGTTCCGCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 27, 4: 280} {0: 1, 1: 0, 2: 1, 3: 22, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!