ID: 903156906_903156915

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 903156906 903156915
Species Human (GRCh38) Human (GRCh38)
Location 1:21451626-21451648 1:21451667-21451689
Sequence CCAGCATGAGCTTCTGTCAGGCC AACAGGGCATAGTGGGTCCTGGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 7, 3: 14, 4: 161} {0: 1, 1: 0, 2: 2, 3: 8, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!