ID: 903179171_903179185

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 903179171 903179185
Species Human (GRCh38) Human (GRCh38)
Location 1:21596945-21596967 1:21596978-21597000
Sequence CCTTGTTCCCTCTGAGTCCAGAG GGGTGATGGAGGCCCAGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 323} {0: 1, 1: 1, 2: 4, 3: 107, 4: 866}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!