ID: 903189010_903189018

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 903189010 903189018
Species Human (GRCh38) Human (GRCh38)
Location 1:21646035-21646057 1:21646067-21646089
Sequence CCTCTCTGAGCGTCAGTTCCCTC ATGGGGATGGACAGTAGTAAGGG
Strand - +
Off-target summary {0: 1, 1: 16, 2: 459, 3: 2225, 4: 6022} {0: 1, 1: 0, 2: 1, 3: 17, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!