ID: 903209904_903209918

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 903209904 903209918
Species Human (GRCh38) Human (GRCh38)
Location 1:21812112-21812134 1:21812163-21812185
Sequence CCTGTGGGTCCTCCTCCCAGAAG CTGGTTCCTGTCTGGCAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 230} {0: 1, 1: 0, 2: 1, 3: 20, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!