ID: 903240317_903240322

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 903240317 903240322
Species Human (GRCh38) Human (GRCh38)
Location 1:21978383-21978405 1:21978398-21978420
Sequence CCACCTTCCTCTCGCCCTTCCAG CCTTCCAGCCGCGTTGTCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 75, 4: 821} {0: 1, 1: 0, 2: 1, 3: 0, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!