ID: 903257339_903257344

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 903257339 903257344
Species Human (GRCh38) Human (GRCh38)
Location 1:22111705-22111727 1:22111732-22111754
Sequence CCTCCCTCTTTCCCAGTTGAAGC TGAATTCATAGCAGCAGCCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!