ID: 903312829_903312832

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 903312829 903312832
Species Human (GRCh38) Human (GRCh38)
Location 1:22473258-22473280 1:22473292-22473314
Sequence CCGCAGGTGATTCTTATGCACAT AAACTGTTCTAGTGGATAAAGGG
Strand - +
Off-target summary {0: 3, 1: 41, 2: 186, 3: 584, 4: 1561} {0: 1, 1: 0, 2: 0, 3: 17, 4: 431}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!