ID: 903375525_903375536

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 903375525 903375536
Species Human (GRCh38) Human (GRCh38)
Location 1:22863400-22863422 1:22863439-22863461
Sequence CCCCCTTCTGCTGAGTCACATGG CTGGATTCACAAAGGGACAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 200} {0: 1, 1: 1, 2: 1, 3: 17, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!