ID: 903440272_903440278

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 903440272 903440278
Species Human (GRCh38) Human (GRCh38)
Location 1:23382864-23382886 1:23382916-23382938
Sequence CCCATCCCTAAGTGCTCAATAAG GGTTTTTACCTTAAAAAATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 111} {0: 1, 1: 0, 2: 1, 3: 57, 4: 517}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!