ID: 903461187_903461205

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 903461187 903461205
Species Human (GRCh38) Human (GRCh38)
Location 1:23522028-23522050 1:23522077-23522099
Sequence CCGAGTCTTCTCCCCGGGGGATT GTCACAGCTCAGGGAGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73} {0: 1, 1: 2, 2: 8, 3: 55, 4: 475}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!