ID: 903510831_903510845

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 903510831 903510845
Species Human (GRCh38) Human (GRCh38)
Location 1:23873873-23873895 1:23873917-23873939
Sequence CCCAGCCTCCTCTGTATTTCCAG GATTATCAGAATATCAGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 341} {0: 1, 1: 1, 2: 0, 3: 18, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!