ID: 903545322_903545331

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 903545322 903545331
Species Human (GRCh38) Human (GRCh38)
Location 1:24120358-24120380 1:24120411-24120433
Sequence CCACCTTTGAACAATGACAGAAG ATTGTGAAACTGGCCAGGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 168} {0: 1, 1: 1, 2: 4, 3: 46, 4: 419}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!