ID: 903646597_903646609

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 903646597 903646609
Species Human (GRCh38) Human (GRCh38)
Location 1:24899901-24899923 1:24899942-24899964
Sequence CCCACTTTGGGCCTTACAGACTC TTTTGTCAGGGGATGGGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 98} {0: 1, 1: 0, 2: 19, 3: 158, 4: 1287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!