ID: 903707609_903707613

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 903707609 903707613
Species Human (GRCh38) Human (GRCh38)
Location 1:25298423-25298445 1:25298441-25298463
Sequence CCTCAAAACTTCAATTCAGCCTG GCCTGGGTTTCTTCAGCAGGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 16, 4: 328} {0: 2, 1: 0, 2: 1, 3: 26, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!