ID: 903710904_903710907

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 903710904 903710907
Species Human (GRCh38) Human (GRCh38)
Location 1:25323412-25323434 1:25323427-25323449
Sequence CCCAAAGGCAACCACTGAACTAC TGAACTACTTTCTGTCACTAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 29, 4: 205} {0: 2, 1: 2, 2: 33, 3: 238, 4: 898}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!