ID: 903722070_903722075

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 903722070 903722075
Species Human (GRCh38) Human (GRCh38)
Location 1:25413132-25413154 1:25413147-25413169
Sequence CCTTCCTCCCCAAGGCTCTACAC CTCTACACTGTCCCTGAGAGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 20, 4: 246} {0: 2, 1: 0, 2: 2, 3: 9, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!