ID: 903740473_903740477

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 903740473 903740477
Species Human (GRCh38) Human (GRCh38)
Location 1:25555857-25555879 1:25555870-25555892
Sequence CCTCAAGGAGCTTCCACTCTAGT CCACTCTAGTTGGGTATAGTCGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 70, 3: 425, 4: 1615} {0: 1, 1: 0, 2: 0, 3: 4, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!