ID: 903803700_903803709

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 903803700 903803709
Species Human (GRCh38) Human (GRCh38)
Location 1:25989173-25989195 1:25989221-25989243
Sequence CCCAAAGACATGTATTTAGACAG GGCTAGTAACTTATAAAGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 211} {0: 1, 1: 0, 2: 2, 3: 14, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!