ID: 903812186_903812194

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 903812186 903812194
Species Human (GRCh38) Human (GRCh38)
Location 1:26040918-26040940 1:26040939-26040961
Sequence CCCCCCCCCATCTCTACAAACAT ATTTAAAAGTTAGCCAGACATGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 38, 3: 258, 4: 810} {0: 2, 1: 84, 2: 1137, 3: 6859, 4: 38744}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!