|
Left Crispr |
Right Crispr |
| Crispr ID |
903812186 |
903812198 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:26040918-26040940
|
1:26040969-26040991
|
| Sequence |
CCCCCCCCCATCTCTACAAACAT |
CGCCTGTGGTCCCAGCTACTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 6, 2: 38, 3: 258, 4: 810} |
{0: 1698, 1: 50471, 2: 116116, 3: 175602, 4: 127583} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|